Introduction to Bioinformatics

Posted by | February 25, 2008 | AMBL PROJECT DETAILS, UNIVERSITY+ | No Comments

This Bioinformatics Workshop is a three-day intensive training workshop that AMBL offers to a professional audience. Current topics in bioinformatics, genomics and proteomics are covered. Participants are introduced to common tools and database resources for bioinformatics. Practical exercises and guided tours give workshop participants hands-on experience with bioinformatics searches, tasks, and analyses.

This workshop was hosted at the Michael Smith Labs in February 2008.

Bioinformatics Workshop Day 1

Jump to:
Day 1
Day 2
Day 3

Day 1 – Links, References & Supplementary Readings

pdfLecture Materials

What is Bioinformatics?
Fox J. http://www.scq.ubc.ca/what-is-bioinformatics/

Sequencing Technologies

Genome Projects: Uncovering the Blueprints of Biology
Kae H. http://www.scq.ubc.ca/genome-projects-uncovering-the-blueprints-of-biology/

DNA Sequencing with Solexa Technology:
http://www.illumina.com/downloads/SS_DNAsequencing.pdf

Molecular biology. Site-seeing by sequencing.
Fields S. Science 316 (2007) 1441-2. [PMID: 17556576]

Whole-genome re-sequencing.
Bentley DR. Curr Opin Genet Dev. 16 (2006) 545-52. [PMID: 17055251]

Public Sequence Databases
http://www.ncbi.nlm.nih.gov/

Database resources of the National Center for Biotechnology Information.
Wheeler DL et al. Nucleic Acids Res. 36 (2008) D13-21. [PMID: 18045790]

The “About Entrez” page at the NCBI
http://www.ncbi.nlm.nih.gov/Database/index.html

Model of Entrez Databases from NCBI
http://www.ncbi.nih.gov/Database/datamodel/index.html

PubMed Tutorial from NLM
http://www.nlm.nih.gov/bsd/pubmed_tutorial/m1001.html

Practical Exercises:
Retrieve records annotated with a given biological feature (e.g., promoter)

DAY 2 – Links, References & Supplementary Readings

pdfLecture Materials

Sequence Similarity Searching

BLAST: Basic Local Alignment Search Tool
http://www.ncbi.nlm.nih.gov/blast/Blast.cgi

Basic local alignment search tool.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ J. Mol. Biol. 215 (1990) 403-410. [PMID: 2231712]

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Altschul SF, Madden TL, Schaeffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ 25 (1997) 3389-3402. [PMID: 9254694]

Practical Exercises:
>DinoDNA from JURASSIC PARK p. 103 nt 1-1200
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG
CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG
ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT
CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT
GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG
CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA
ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC
GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG
CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG
CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT

>DinoDNA from THE LOST WORLD p. 135
GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG
GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC
ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA
GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC
TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG
ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG
CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC
GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG
GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC
TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC
CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA
TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC
GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC
GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG
GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC
TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC
GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT
TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA
ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA
CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC
CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT
GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG
AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC
TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC

Accessing Genome Annotations with Genome Browsers

UCSC Genome Browser
http://genome.cse.ucsc.edu/

Ensembl Genome Browser
http://www.ensembl.org/index.html

NCBI MapViewer
http://www.ncbi.nlm.nih.gov/mapview/index.html

DAY 3 – Links, References & Supplementary Readings

pdf Lecture Materials

Discovering GEO – the Gene Expression Omnibus

The use and analysis of microarray data.
Butte A. Nat Rev Drug Discov. 12 (2002) 951-60. [PMID: 12461517]

NCBI GEO: mining tens of millions of expression profiles–database and tools update.
Barrett T, et al. Nucleic Acids Res. 35 (2007) D760-5. [PMID: 17099226]

GEO: the Gene Expression Omnibus
http://www.ncbi.nlm.nih.gov/projects/geo/info/GEOHandoutFinal.pdf

Pathway Resources for Systems Biology

Pathway information for systems biology.
Cary MP, Bader GD, Sander C. FEBS Letters 579 (2005) 1815-1820 [PMID: 15763557]

Cytoscape
http://cytoscape.org/index.php

Finding online tools & resources for Life Sciences research

Bioinformatics Links Directory
http://bioinformatics.ca/links_directory/

Conducting research on the web: 2007 update for the bioinformatics links directory.
Fox JA, McMillan S, Ouellette BF. Nucleic Acids Res. 35 (2007) W3-5. [PMID: 17586821]

NAR Database Collection
http://www.oxfordjournals.org/nar/database/c

Workshop Evaluation:

Click Here to take survey

Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.